bend.it® Server: Tables

Table 1. Trinucleotide parameter sets for DNA-bendability

Trinucleotide DNase I-based bendability
[2]
Consensus bendability
[3]
Trinucleotide

DNase I-based bendability
[2]

Consensus bendability
[3]
AAA/TTT 0.1 0.05 CAG/CTG 9.6 6.90
AAC/GTT 1.6 2.65 CCA/TGG 0.7 3.05
AAG/CTT 4.2 4.70 CCC/GGG 5.7 5.85
AAT/ATT 0.0 0.35 CCG/CGG 3.0 3.85
ACA/TGT 5.8 5.50 CGA/TCG 5.8 7.05
ACC/GGT 5.2 5.30 CGC/GCG 4.3 5.90
ACG/CGT 5.2 5.30 CTA/TAG 7.8 5.00
ACT/AGT 2.0 3.90 CTC/GAG 6.6 6.00
AGA/TCT 6.5 4.90 GAA/TTC 5.1 4.05
AGC/GCT 6.3 6.90 GAC/GTC 5.6 5.50
AGG/CCT 4.7 5.05 GCA/TGC 7.5 6.75
ATA/TAT 9.7 6.25 GCC/GGC 8.2 9.10
ATC/GAT 3.6 4.45 GGA/TCC 6.2 5.00
ATG/CAT 8.7 7.70 GTA/TAC 6.4 5.05
CAA/TTG 6.2 4.75 TAA/TTA 7.3 4.65
CAC/GTG 6.8 6.65 TCA/TGA 10.0 7.70


Table 2. Selected curved and straight DNA sequences evaluated with the DNase I
and the consensus scale

No.

Sequence motif Bendability
[arbitrary units]
Predicted curvature
[degree/helical turn]
DNaseI Consensus DNaseI Consensus
Curved DNA
1 (aaaattttgc)n 2.8 2.4 21.1 17.4
2 (aaaattttcg)n 2.2 2.3 16.6 17.2
3 (tctcaaaaaacgcgaaaaaaccggaaaaaagc)n 3.2 3.2 15.4 15.9
4 (ccgaaaaagg)n 3.9 4.3 17.1 20.2
5 (tctctaaaaaatatataaaaa)n 4.5 3.2 27.6 18.5
6 (ggcaaaaaac)n 3.2 3.3 19.2 19.5
7 ccaaaaatgtcaaaaaataggcaaaaaatgcc - Leishmania tarentolae kinetoplast 3.9 3.5 21.8 20.5
8 aaaaactctctaaaaactctccctagaggggccctagagggc 5.2 4.6 13.6 12.8
9 aaaaactctctaaaaactctctagaggggccctagagggccc 5.1 4.6 13.3 13.2
10 agaattgggacaaaaattggaaatttttaaggg - Columba risoria bent satellite DNA 3.3 3.0 13.5 12.6
11 (aaaaactctctaaaaactctcgaggggccctagagggcccta)n 5.0 4.7 13.8 10.8
Straight DNA
12 (atctaatctaacacaacaca)n 5.1 4.4 0.8 0.8
13 actacgttaaatctatcaccgcaagggataaa - OR3 operator region 5.0 4.4 10.4 7.8
14 actacgttaaatctatcaccacaagggataaa - OR3 region, mutated 4.9 4.4 10.6 8.1
15 (a)n - poly-A 0.100 0.063 0.002 0.002
16 (ttttaaaacg)n 2.8 2.5 2.3 4.2
17 (ttttaaaagc)n 3.6 3.3 3.0 9.6
18 (aaaaactctctaaaaactctcgggccctagaggggccctaga)n 4.9 4.6 12.8 8.3

Andrei Gabrielian, Kristian Vlahovicek & Sándor Pongor